Talk:Biosynthesis of DMT in modified organisms using genetic engineering

From PsychonautWiki
Jump to navigation Jump to search
Songbird-egg.svg

This article is a stub.

As such, it may contain incomplete or wrong information. You can help by expanding it.

Dialog-warning.svg

Disclaimer:

This guide is provided for informational and educational purposes only. We do not encourage you to break the law and cannot claim any responsibility for your actions.

Fc906056bb7f24546fd8af645ad4c08d.jpg

The use of Genetic engineering to create the Biosynthesis of DMT in modified organisms

Introduction

As of June 2017 nobody has ever made a modification in a organism to produce DMT.

This article contemplate the research that is going on in this subject.

Simplified steps to achieve the goal

  1. Learn about the genes involved Biosynthesis of DMT in a specific organism that produce it like humans or Mimosa hostilis.
  2. Choose a organism that do not create DMT naturally like E.Coli or a specific plant.
  3. Write the plasmid digitally
  4. Send the plasmid info (digital) to any place that sell plasmid and Buy the sequence that you want
  5. Introduce the plasmid into the organisms (at home or pay a laboratoy)
  6. Grow organisms that are producing DMT
  7. Harvest dmt using some Tek

The theory - Research on how to do the gene modification

Biosynthesis of DMT in humans

Dimethyltryptamine is an indole alkaloid derived from the shikimate pathway.

the biosynthesis of DMT is relatively simple.

Biosynthetic pathway for N,N-dimethyltryptamine

L-tryptophan that we cosume is transformed in DMT in 4 step listed below.

Humans cannot produce L-tryptophan, so we need to eat it. Tryptophan is a routine constituent of most protein-based foods or dietary proteins. It is particularly plentiful in milk, yogurt, cottage cheese, red meat, eggs, etc.

L-Tryptophan

It begins with its decarboxylation (a chemical reaction that removes a carboxyl group and releases carbon dioxide (CO2)) of L-tryptophan by an aromatic amino acid decarboxylase (AADC) enzyme

Aromatic L-amino acid decarboxylase (AADC)

(step 1). The resulting decarboxylated tryptophan analog is tryptamine.

tryptamine

Tryptamine then undergoes a transmethylation

(step 2): the enzyme indolethylamine-N-methyltransferase (INMT) catalyzes the transfer of a methyl group from cofactor S-adenosyl-methionine (SAM), via nucleophilic attack, to tryptamine.

Amine N-methyltransferase (INMT)

This reaction transforms SAM into S-adenosylhomocysteine (SAH), and gives the intermediate product N-methyltryptamine (NMT).

N-Methyltryptamine (NMT) has been found in the bark, shoots and leaves of several plant genera, including Virola, Acacia, Mimosa

[1][2] NMT is in turn transmethylated by the same process

(step 3) to form the end product N,N-dimethyltryptamine. Tryptamine transmethylation is regulated by two products of the reaction: SAH,[3][4][5] and DMT[3][5] were shown ex vivo to be among the most potent inhibitors of rabbit INMT activity.

This transmethylation mechanism has been repeatedly and consistently proven by radiolabeling of SAM methyl group with carbon-14 (14C-CH3)SAM).[1][3][5][6][7]

DMT and the human DNA

Dmt in humans is created with genes located in Chromosome 7.

the genes are listed below

Amine N-methyltransferase

Amine N-methyltransferase (INMT)
EntrezGene = 21743
UniProt = P40936

Template:Enzyme

In enzymology, an Amine N-methyltransferase (Template:EC number) is an enzyme that is ubiquitously present in non-neural tissues and that catalyzes the N-methylation of tryptamine and structurally related compounds.[8]

The chemical reaction taking place is:

Thus, the two substrates of this enzyme are S-adenosyl methionine and amine, whereas its two products are S-adenosylhomocysteine and methylated amine. In the case of tryptamine and serotonin these then become the dimethylated indolethylamines dimethyltryptamine (DMT) and bufotenine.[9]

This enzyme belongs to the family of transferases, specifically those transferring one-carbon group methyltransferases. The systematic name of this enzyme class is S-adenosyl-L-methionine:amine N-methyltransferase. Other names in common use include nicotine N-methyltransferase, tryptamine N-methyltransferase, indolethylamine N-methyltransferase, and arylamine N-methyltransferase. This enzyme participates in tryptophan metabolism.

A wide range of primary, secondary and tertiary amines can act as acceptors, including tryptamine, aniline, nicotine and a variety of drugs and other xenobiotics.[8]


N-methylation of endogenous and xenobiotic compounds is a major method by which they are degraded. This gene encodes an enzyme that N-methylates indoles such as tryptamine. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream FAM188B (family with sequence similarity 188, member B) gene. [provided by RefSeq, Nov 2010]

Enzyme encoded into DNA

atggaggggaaagtctatatcgggggggagttctatgagaaagagttcacacccaaattc tatctgacaacatattatagcttccatagcgggcccgtcgccgagcaagagatcgtcaaa 
ttcagcctgcaaaatctgtatcaaacattcagcacagggggggtcggggggttcgtcctg atcttcatcgggagcgggcccacaatctatcaactgctgagcgcctgcgaggtcttcaga 
gagatcatcgtcacattctatacaccccaaaatctgcaagagctgcaaaaatggctgaaa aaagagcccggggcctatttctggagcagcatcgtccaacatgcctgcgagctggagggg 
ttcagaagcagatggcaagagaaagaggccaaactgagaagaacagtcacaagagtcctg agatgcttcgtcacaaaaacaccccccctggggagcgcccaagtccccctggccttctgc 
gtcctgacattcctggccatggagtgcgcctgccccttcatcttcacatatagagccgcc ctgagaagactggccgggctgctgaaacccggggggcatctggtcacactggtcacactg 
agattccaacattatatggtcgggcccaaaaaattcagcggggtctatctggagaaagag 
gtcgtcgagaaagccatccaattcgccgggtgccaagtcctgaaatgcaattgcgtcagc  
ctgagctatagcgaggcctattgcagccatttcgggctgtgcttcgtcgtcgccagaaaa 
gggcccagc

DNA above is two steps away from the translation done by the ribosome. DNA is transcribed into RNA by DNA transcriptase, RNA is translated into proteins by ribosomes. But we are interested in the DNA that we can put into the organism, so that is why I worked my way backwards to DNA.

Aromatic L-amino acid decarboxylase

Aromatic L-amino acid decarboxylase (AADC or AAAD)

http://www.uniprot.org/uniprot/O88533

Template:Enzyme Template:Infobox protein Aromatic L-amino acid decarboxylase (AADC or AAAD), also known as DOPA decarboxylase, tryptophan decarboxylase, and 5-hydroxytryptophan decarboxylase, is a lyase enzyme (Template:EC number).

Reactions

AADC catalyzes several different decarboxylation reactions:[10]

The enzyme uses pyridoxal phosphate, the active form of vitamin B6, as a cofactor. Template:Phenylalanine biosynthesis

Human serotonin biosynthesis pathway

Template:Clear left

  • Below is the DNA sequence that codes for the protein above
atgttcagcagagagttcagaagaagagggaaagagatggtcttctatatcgccttctat
ctgttcgggatcgaggggagacccgtctatcccttcgtcgagcccgggtatctgagaccc
ctgatccccgccacagccccccaagagcccgagacatatgagttcatcatcaaattcatc
gagaaaatcatcatgcccggggtcacacattggcatagcccctatttcttcgcctatttc
cccacagccagcagctatcccgccatgctggccttcatgctgtgcggggccatcgggtgc
atcgggttcagctgggccgccagccccgcctgcacagagctggagacagtcatgatgttc
tggctggggaaaatgctggagctgcccgaggccttcctggccgggagagccggggagggg
gggggggtcatccaagggagcgccagcgaggccacactggtcgccctgctggccgccaga
acaaaagtcatcagacaactgcaagccgccagccccgagttcacacaagccgccatcatg
gagaaactggtcgcctatacaagcttccaagcccatagcagcgtcgagagagccgggctg
atcggggggatcaaactgaaagccgtccccagcttcgggaatttcagcatgagagccagc
gccctgagagaggccctggagagattcaaagccgccgggctgatccccttcttcgtcgtc
gccacactggggacaacaagctgctgcagcttcttcaatctgctggaggtcgggcccatc
tgcaatcaagagggggtctggctgcatatcttcgccgcctatgccgggagcgccttcatc
tgccccgagttcagatatctgctgaatggggtcgagttcgccttcagcttcaatttcaat
ccccataaatggctgctggtcaatttcttctgcagcgccatgtgggtcaaaagaagaaca
ttcctgacaggggccttcaatatgttccccgtctatctgaaacatagccatcaattcagc
gggttcatcacattctatagacattggcaaatccccctggggagaagattcagaagcctg
aaaatgtggttcgtcttcagaatgtatggggtcaaagggctgcaagcctatatcagaaaa
catgtcgagctgagccatgagttcgagagcctggtcagacaattccccagattcgagatc
tgcacagaggtcatcctggggctggtctgcttcagactgaaagggagcaatgagctgaat
gagacactgctgcaaagaatcaatagcgccaaaaaaatccatctggtcccctgcagactg
agattcaaattcgtcctgagattcgccgtctgcgccagaacagtcgagagcgcccatgtc
caactggcctgggagcatatcagcttcctggccagcagcgtcctgagagccgagaaagag

Construct a digital plasmid

plasmid

The basic idea is to extend the metabolic pathway of e coli by inserting new genes into it. The genes code for proteins that make it happen (exactly like described in https://en.wikipedia.org/wiki/N,N-Dimethyltryptamine#Biosynthesis). It is possible to buy synthetic genes on plasmids from the internet for a few hundred dollars. Plasmids are circular strings of DNA that, when bought from synthesizers also often encode for resistance against some form of antibiotics, such as amplifilin. The idea is that after you have inserted the plasmid into a colony of E. coli, you add the antibiotic specific to the plasmid in order to kill off all individual organisms that did not absorb the plasmid. Insertion of genes with the help of a plasmid vector is very well described and can be done in a kitchen. There are youtube tutorials. For example, https://www.youtube.com/watch?v=slY4qrnZIM8.

L-Tryptophan, one of the 22 essential amino-acids (which exist in all living bodies), is transformed into DMT through interaction with two enzymes: AAAD (Aromatic L-amino acid decarboxylase) and INMT (Amine N-methyltransferase).

E. coli lacks both these enzymes.

These enzymes consume co-enzymes that are available in the e.coli.

(You can look up the available chemicals in e coli and their relationship with its genome by using ecocyc.org or biocyc.org.)

If E.coli contained AAAD and INMT, they would interact with other chemicals present in the cell and produce new chemicals. Going through the list of all chemicals that can interact with the two enzymes, I found that AAAD would produce the phenetylamine and tyramine as a by-product. This is important, as ingesting tyramine in combination with a mono-amine oxidase inhibitor (MAOI) could cause hypertensive crisis. This could be lethal to a psychedelic user ingesting the product.


I took the code for the enzymes from uniprot.org and compiled them into the DNA. For procaryotes this means that one simply translated each amino-acid into codons (DNA-basepair triplets) that code for them.

The other parts it took from the biobricks project: An annual competition held by universities to teach students to genetically modify organisms into doing various mostly useful things. (http://parts.igem.org/Catalog?title=Catalog) The biobricks project is also quite a useful place to start off ones own studies, its very pedagogical.

The central dogma of genetics is that DNA is transcribed into RNA, that is then translated into sequences of amino-acids. These sequences are proteins, and enzymes are proteins.

BBa_I14033

http://parts.igem.org/Part:BBa_I14033

http://beta.labgeni.us/registries/parts_registry/?part=BBa_I14033

promoter

>BBa_I14033 Part-only sequence. Constitutive Promoter, Medium Transcription (38 bp)

ggcacgtaagaggttccaactttcaccataatgaaaca

The promoter recruits transcriptional machinery, that attach to the DNA and transcribes it into mRNA.

The transcription strength is perhaps one of the most important knobs one could experiment with. Too high transcription would result in too much of the organisms metabolic system being kidnapped for the manufacture of enzymes, which would slow growth. A too low transcription would result in an organism that does not produce enough amounts of DMT.

BBa_B0029

http://parts.igem.org/Part:BBa_B0029

Ribosome Binding Site (RBS)

>BBa_B0029 Part-only sequence (15 bp)

ttcacacaggaaacc


The RBS binds the mRNA to ribosomes, that translates the mRNA into amino acids.

The rest of the gene below, with the exception of the terminator, is code that will be translated into enzymes. Both enzymes start with methodine, which is also a start-codon. This means that no "cutting and pasting" is needed. Between the code that translates to the enzymes, there are stop codons and a spacer that does not initiate translation.

spacer 1

Makes the ribosome stop translation. The ribosome continues its travel down the single-helix RNA though, so it will encounter the next enzyme-encoding sequence as well.

> spacer

actgtattccta

Does nothing at all, just to separate the proteins in space, and give the ribosome a chance to properly emit the INMT before beginning on the AAAD.

Stop codon tagtag

BBa_B0012

Terminates translation and makes the ribosome emit the protein.

>BBa_B0012 Part-only sequence (41 bp)

tcacactggctcaccttcgggtgggcctttctgcgtttata


Terminator that forms a physical loop out of the single-helix RNA equivalent. The loop is formed by the palindrome contained within the sequence. Read more about it at biobricks wiki under the topic terminators.

Final

The whole sequence looks like this:

ggcacgtaagaggttccaactttcaccataatgaaacattcacacagga aaccatggaggggaaagtctatatcgggggggagttctatgagaaagag ttcacacccaaattctatctgacaacatattatagcttccatagcgggc ccgtcgccgagcaagagatcgtcaaattcagcctgcaaaatctgtatca aacattcagcacagggggggtcggggggttcgtcctgatcttcatcggg agcgggcccacaatctatcaactgctgagcgcctgcgaggtcttcagag agatcatcgtcacattctatacaccccaaaatctgcaagagctgcaaaa atggctgaaaaaagagcccggggcctatttctggagcagcatcgtccaa catgcctgcgagctggaggggttcagaagcagatggcaagagaaagagg ccaaactgagaagaacagtcacaagagtcctgagatgcttcgtcacaaa aacaccccccctggggagcgcccaagtccccctggccttctgcgtcctg acattcctggccatggagtgcgcctgccccttcatcttcacatatagag ccgccctgagaagactggccgggctgctgaaacccggggggcatctggt cacactggtcacactgagattccaacattatatggtcgggcccaaaaaa ttcagcggggtctatctggagaaagaggtcgtcgagaaagccatccaat tcgccgggtgccaagtcctgaaatgcaattgcgtcagcctgagctatag cgaggcctattgcagccatttcgggctgtgcttcgtcgtcgccagaaaa gggcccagctagtagactgtattcctaatgttcagcagagagttcagaa gaagagggaaagagatggtcttctatatcgccttctatctgttcgggat cgaggggagacccgtctatcccttcgtcgagcccgggtatctgagaccc ctgatccccgccacagccccccaagagcccgagacatatgagttcatca tcaaattcatcgagaaaatcatcatgcccggggtcacacattggcatag cccctatttcttcgcctatttccccacagccagcagctatcccgccatg ctggccttcatgctgtgcggggccatcgggtgcatcgggttcagctggg ccgccagccccgcctgcacagagctggagacagtcatgatgttctggct ggggaaaatgctggagctgcccgaggccttcctggccgggagagccggg gagggggggggggtcatccaagggagcgccagcgaggccacactggtcg ccctgctggccgccagaacaaaagtcatcagacaactgcaagccgccag ccccgagttcacacaagccgccatcatggagaaactggtcgcctataca agcttccaagcccatagcagcgtcgagagagccgggctgatcgggggga tcaaactgaaagccgtccccagcttcgggaatttcagcatgagagccag cgccctgagagaggccctggagagattcaaagccgccgggctgatcccc ttcttcgtcgtcgccacactggggacaacaagctgctgcagcttcttca atctgctggaggtcgggcccatctgcaatcaagagggggtctggctgca tatcttcgccgcctatgccgggagcgccttcatctgccccgagttcaga tatctgctgaatggggtcgagttcgccttcagcttcaatttcaatcccc ataaatggctgctggtcaatttcttctgcagcgccatgtgggtcaaaag aagaacattcctgacaggggccttcaatatgttccccgtctatctgaaa catagccatcaattcagcgggttcatcacattctatagacattggcaaa tccccctggggagaagattcagaagcctgaaaatgtggttcgtcttcag aatgtatggggtcaaagggctgcaagcctatatcagaaaacatgtcgag ctgagccatgagttcgagagcctggtcagacaattccccagattcgaga tctgcacagaggtcatcctggggctggtctgcttcagactgaaagggag caatgagctgaatgagacactgctgcaaagaatcaatagcgccaaaaaa atccatctggtcccctgcagactgagattcaaattcgtcctgagattcg ccgtctgcgccagaacagtcgagagcgcccatgtccaactggcctggga gcatatcagcttcctggccagcagcgtcctgagagccgagaaagagtag tagtcacactggctcaccttcgggtgggcctttctgcgtttata

Appling the theory to actually modify a organism

Buy the gene on a plasmid from some online shop

with the knowledge of the genes needed to produce DMT you have to send it to a Online shops selling synthetic DNA and buy it on a plasmid.


Online shops selling synthetic DNA:

Introduce the plasmid into a population of chosen organisms

with the plasmid in hands you have to introduce it on a organism like E.coli

Grow organisms assimilate the plasmid

kill off organisms that did not assimilate the plasmid using a pencilin

Dry the biomass and harvest it using straight to base, or similiar

using some of Tek Extractions

More information

Foruns discussions

There has been a lot of reseach on online forums on how to create a organism that produces dmt using genetic engineering. Here is a list of most important threads on this subject.

DMT-Nexus

reddit

shroomery

Related projects

  1. ↑ 1.0 1.1 Axelrod J. (August 1961). "Enzymatic formation of psychotomimetic metabolites from normally occurring compounds". Science. 134 (3475): 343. doi:10.1126/science.134.3475.343. PMID 13685339. 
  2. ↑ Rosengarten H.; Friedhoff A.J. (1976). "A review of recent studies of the biosynthesis and excretion of hallucinogens formed by methylation of neurotransmitters or related substances" (PDF). Schizophrenia Bulletin. 2 (1): 90–105. doi:10.1093/schbul/2.1.90. PMID 779022. 
  3. ↑ 3.0 3.1 3.2 Barker S.A.; Monti J.A.; Christian S.T. (1981). "N, N-dimethyltryptamine: an endogenous hallucinogen". International Review of Neurobiology. International Review of Neurobiology. 22: 83–110. doi:10.1016/S0074-7742(08)60291-3. ISBN 978-0-12-366822-6. PMID 6792104. 
  4. ↑ Lin R.L.; Narasimhachari N.; Himwich H.E. (September 1973). "Inhibition of indolethylamine-N-methyltransferase by S-adenosylhomocysteine". Biochemical and Biophysical Research Communications. 54 (2): 751–9. doi:10.1016/0006-291X(73)91487-3. PMID 4756800. 
  5. ↑ 5.0 5.1 5.2 Thompson M.A.; Weinshilboum R.M. (December 1998). "Rabbit lung indolethylamine N-methyltransferase. cDNA and gene cloning and characterization". Journal of Biological Chemistry. 273 (51): 34502–10. doi:10.1074/jbc.273.51.34502. PMID 9852119. Retrieved 2010-11-09. 
  6. ↑ Mandel L.R.; Prasad R.; Lopez-Ramos B.; Walker R.W. (January 1977). "The biosynthesis of dimethyltryptamine in vivo". Research Communications in Chemical Pathology and Pharmacology. 16 (1): 47–58. PMID 14361. 
  7. ↑ Thompson M.A.; Moon E.; Kim U.J.; Xu J.; Siciliano M.J.; Weinshilboum R.M. (November 1999). "Human indolethylamine N-methyltransferase: cDNA cloning and expression, gene cloning, and chromosomal localization" (PDF). Genomics. 61 (3): 285–97. doi:10.1006/geno.1999.5960. PMID 10552930. 
  8. ↑ 8.0 8.1 Template:MeshName
  9. ↑ J., Kärkkäinen; T. Forsström; J. Tornaeus; K. Wähälä; P. Kiuru; A. Honkanen; U. -H. Stenman; U. Turpeinen; A. Hesso (April 2005). "Potentially hallucinogenic 5-hydroxytryptamine receptor ligands bufotenine and dimethyltryptamine in blood and tissues". Scandinavian Journal of Clinical and Laboratory Investigation. 65 (3): 189–199. doi:10.1080/00365510510013604. PMID 16095048. Retrieved October 15, 2008. 
  10. ↑ "AADC". Human Metabolome database. Retrieved 17 February 2015.